Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104096 |
| Name | oriT_pEA16-1_2  |
| Organism | Escherichia albertii strain BIA_16-1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP117652 (31206..31329 [-], 124 nt) |
| oriT length | 124 nt |
| IRs (inverted repeats) | 101..106, 119..124 (TTTAAT..ATTAAA) 91..99, 113..121 (AATAATGTA..TACATTATT) 90..95, 107..112 (AAATAA..TTATTT) 88..93, 105..110 (ATAAAT..ATTTAT) 39..46, 49..56 (GCAAAAAC..GTTTTTGC) 3..10, 15..22 (TTGGTGGT..ACCACCAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_pEA16-1_2
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTGGGTTATGTTATAAATAATGTATTTTAATTTATTTTACATTATTAAA
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTGGGTTATGTTATAAATAATGTATTTTAATTTATTTTACATTATTAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4535 | GenBank | NZ_CP117652 |
| Plasmid name | pEA16-1_2 | Incompatibility group | IncFIB |
| Plasmid size | 52153 bp | Coordinate of oriT [Strand] | 31206..31329 [-] |
| Host baterium | Escherichia albertii strain BIA_16-1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | cofA |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |