Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104096
Name   oriT_pEA16-1_2 in_silico
Organism   Escherichia albertii strain BIA_16-1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP117652 (31206..31329 [-], 124 nt)
oriT length   124 nt
IRs (inverted repeats)      101..106, 119..124  (TTTAAT..ATTAAA)
 91..99, 113..121  (AATAATGTA..TACATTATT)
 90..95, 107..112  (AAATAA..TTATTT)
 88..93, 105..110  (ATAAAT..ATTTAT)
 39..46, 49..56  (GCAAAAAC..GTTTTTGC)
 3..10, 15..22  (TTGGTGGT..ACCACCAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 124 nt

>oriT_pEA16-1_2
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTGGGTTATGTTATAAATAATGTATTTTAATTTATTTTACATTATTAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4535 GenBank   NZ_CP117652
Plasmid name   pEA16-1_2 Incompatibility group   IncFIB
Plasmid size   52153 bp Coordinate of oriT [Strand]   31206..31329 [-]
Host baterium   Escherichia albertii strain BIA_16-1

Cargo genes


Drug resistance gene   -
Virulence gene   cofA
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -