Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104094
Name   oriT_pEA35_3 in_silico
Organism   Escherichia albertii strain BIA_35
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP117598 (3627..3910 [-], 284 nt)
oriT length   284 nt
IRs (inverted repeats)      245..250, 253..258  (CGCCCC..GGGGCG)
 119..127, 137..145  (GCGGTGTTG..CAACACCGC)
 31..38, 41..48  (GCAAAAAC..GTTTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 284 nt

>oriT_pEA35_3
GTTCTCATGCCTGAAATGCCCACACCCCACGCAAAAACAAGTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGACAAATTAGTTCTTCTTGCTCTCTTTGTGATATTTAAAAAAGCGGTGTTGGCGCAGCTACAACACCGCGCCGACACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAACATCATCTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTACAGGACGCCCCTGGGGGCGCTGCTAGGGGTGTCTGTTCAGATATG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4533 GenBank   NZ_CP117598
Plasmid name   pEA35_3 Incompatibility group   ColRNAI
Plasmid size   6761 bp Coordinate of oriT [Strand]   3627..3910 [-]
Host baterium   Escherichia albertii strain BIA_35

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -