Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104091 |
| Name | oriT_pEA50_41  |
| Organism | Escherichia albertii strain BIA_50 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP117574 (1146..1231 [+], 86 nt) |
| oriT length | 86 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 86 nt
>oriT_pEA50_41
GGGTGTCGGGGCAAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
GGGTGTCGGGGCAAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4530 | GenBank | NZ_CP117574 |
| Plasmid name | pEA50_41 | Incompatibility group | Col |
| Plasmid size | 1627 bp | Coordinate of oriT [Strand] | 1146..1231 [+] |
| Host baterium | Escherichia albertii strain BIA_50 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |