Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104088 |
| Name | oriT_pEA17_3  |
| Organism | Escherichia albertii strain BIA_17 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP117646 (1223..1311 [+], 89 nt) |
| oriT length | 89 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 89 nt
>oriT_pEA17_3
GGGTGTCGGGGTGAAGCCCTGACCAGATAGGCAATTGTGATAGTGTCGCGGGTGACAGTATTACATTTGCACATCCTGTCCCGATTTTT
GGGTGTCGGGGTGAAGCCCTGACCAGATAGGCAATTGTGATAGTGTCGCGGGTGACAGTATTACATTTGCACATCCTGTCCCGATTTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4527 | GenBank | NZ_CP117646 |
| Plasmid name | pEA17_3 | Incompatibility group | Col |
| Plasmid size | 1590 bp | Coordinate of oriT [Strand] | 1223..1311 [+] |
| Host baterium | Escherichia albertii strain BIA_17 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |