Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104086 |
| Name | oriT_pEA11_1  |
| Organism | Escherichia albertii strain BIA_11 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP117669 (46836..46958 [+], 123 nt) |
| oriT length | 123 nt |
| IRs (inverted repeats) | 100..105, 118..123 (TTTAAT..ATTAAA) 90..98, 112..120 (AATAATGTA..TACATTATT) 89..94, 106..111 (AAATAA..TTATTT) 40..47, 60..67 (AAAAACAA..TTGTTTTT) 38..45, 48..55 (GCAAAAAC..GTTTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 123 nt
>oriT_pEA11_1
GTTGGTTGTTCTCACCACAAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGTTTTTTGAATCATTAGCTTATGTTCTAAATAATGTATTTTAATTTATTTTACATTATTAAA
GTTGGTTGTTCTCACCACAAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGTTTTTTGAATCATTAGCTTATGTTCTAAATAATGTATTTTAATTTATTTTACATTATTAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 46259..53859
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PS054_RS23780 (PS054_23780) | 42494..42708 | - | 215 | Protein_39 | S24 family peptidase | - |
| PS054_RS23785 (PS054_23785) | 42689..43042 | + | 354 | Protein_40 | hypothetical protein | - |
| PS054_RS23790 (PS054_23790) | 43128..43277 | + | 150 | Protein_41 | conjugation system SOS inhibitor PsiB family protein | - |
| PS054_RS23795 (PS054_23795) | 43311..43842 | + | 532 | Protein_42 | plasmid SOS inhibition protein A | - |
| PS054_RS23800 (PS054_23800) | 43839..44153 | + | 315 | WP_273815704 | theronine dehydrogenase | - |
| PS054_RS23805 (PS054_23805) | 44307..44456 | + | 150 | Protein_44 | plasmid maintenance protein Mok | - |
| PS054_RS23810 (PS054_23810) | 44398..44523 | + | 126 | WP_089521964 | type I toxin-antitoxin system Hok family toxin | - |
| PS054_RS23815 (PS054_23815) | 44815..45036 | + | 222 | Protein_46 | hypothetical protein | - |
| PS054_RS23820 (PS054_23820) | 45141..45962 | + | 822 | WP_273815709 | DUF932 domain-containing protein | - |
| PS054_RS23825 (PS054_23825) | 46259..46792 | - | 534 | WP_273815711 | transglycosylase SLT domain-containing protein | virB1 |
| PS054_RS23830 (PS054_23830) | 47186..47569 | + | 384 | WP_273815714 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| PS054_RS23835 (PS054_23835) | 47764..48450 | + | 687 | WP_273815716 | PAS domain-containing protein | - |
| PS054_RS23840 (PS054_23840) | 48540..48767 | + | 228 | WP_001254386 | conjugal transfer relaxosome protein TraY | - |
| PS054_RS23845 (PS054_23845) | 48801..49160 | + | 360 | WP_273815718 | type IV conjugative transfer system pilin TraA | - |
| PS054_RS23850 (PS054_23850) | 49175..49486 | + | 312 | WP_000012106 | type IV conjugative transfer system protein TraL | traL |
| PS054_RS23855 (PS054_23855) | 49508..50074 | + | 567 | WP_000399792 | type IV conjugative transfer system protein TraE | traE |
| PS054_RS23860 (PS054_23860) | 50061..50789 | + | 729 | WP_273815720 | type-F conjugative transfer system secretin TraK | traK |
| PS054_RS23865 (PS054_23865) | 50789..52216 | + | 1428 | WP_273815723 | F-type conjugal transfer pilus assembly protein TraB | traB |
| PS054_RS23870 (PS054_23870) | 52206..52796 | + | 591 | WP_273815725 | conjugal transfer pilus-stabilizing protein TraP | - |
| PS054_RS23875 (PS054_23875) | 52783..53103 | + | 321 | WP_273815727 | conjugal transfer protein TrbD | virb4 |
| PS054_RS23880 (PS054_23880) | 53096..53347 | + | 252 | WP_273815728 | conjugal transfer protein TrbG | - |
| PS054_RS23885 (PS054_23885) | 53344..53859 | + | 516 | WP_273815730 | type IV conjugative transfer system lipoprotein TraV | traV |
| PS054_RS23890 (PS054_23890) | 53994..54215 | + | 222 | WP_213852945 | conjugal transfer protein TraR | - |
| PS054_RS23895 (PS054_23895) | 54543..54590 | + | 48 | Protein_62 | hypothetical protein | - |
| PS054_RS23900 (PS054_23900) | 54639..55577 | + | 939 | Protein_63 | type IV secretion system DNA-binding domain-containing protein | - |
| PS054_RS23905 (PS054_23905) | 55519..55917 | - | 399 | WP_273815637 | type II toxin-antitoxin system VapC family toxin | - |
| PS054_RS23910 (PS054_23910) | 55917..56144 | - | 228 | WP_000450526 | toxin-antitoxin system antitoxin VapB | - |
Host bacterium
| ID | 4525 | GenBank | NZ_CP117669 |
| Plasmid name | pEA11_1 | Incompatibility group | IncFIB |
| Plasmid size | 110945 bp | Coordinate of oriT [Strand] | 46836..46958 [+] |
| Host baterium | Escherichia albertii strain BIA_11 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |