Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104074
Name   oriT_pEA47_2 in_silico
Organism   Escherichia albertii strain BIA_47
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP117582 (659..941 [+], 283 nt)
oriT length   283 nt
IRs (inverted repeats)      244..249, 252..257  (CGCCCC..GGGGCG)
 184..189, 197..202  (ATAAAA..TTTTAT)
 31..36, 43..48  (GCAAAA..TTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 283 nt

>oriT_pEA47_2
GTTCTCATGCCTGAAATGCCCACACCCCACGCAAAACCAACTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGAAAAATTAGTTTCTCTTACTCTCTTTGTGATATTTAAAAAAGCGGTGCCGGCGCGGCTACGACACCGCGCCGGCACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAACATAATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTACAGGACGCCCCCAGGGGCGCTGCTAGGGGTGTCTGCTCAGATATG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4513 GenBank   NZ_CP117582
Plasmid name   pEA47_2 Incompatibility group   ColRNAI
Plasmid size   2720 bp Coordinate of oriT [Strand]   659..941 [+]
Host baterium   Escherichia albertii strain BIA_47

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -