Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 104074 |
Name | oriT_pEA47_2 |
Organism | Escherichia albertii strain BIA_47 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP117582 (659..941 [+], 283 nt) |
oriT length | 283 nt |
IRs (inverted repeats) | 244..249, 252..257 (CGCCCC..GGGGCG) 184..189, 197..202 (ATAAAA..TTTTAT) 31..36, 43..48 (GCAAAA..TTTTGC) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 283 nt
>oriT_pEA47_2
GTTCTCATGCCTGAAATGCCCACACCCCACGCAAAACCAACTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGAAAAATTAGTTTCTCTTACTCTCTTTGTGATATTTAAAAAAGCGGTGCCGGCGCGGCTACGACACCGCGCCGGCACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAACATAATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTACAGGACGCCCCCAGGGGCGCTGCTAGGGGTGTCTGCTCAGATATG
GTTCTCATGCCTGAAATGCCCACACCCCACGCAAAACCAACTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGAAAAATTAGTTTCTCTTACTCTCTTTGTGATATTTAAAAAAGCGGTGCCGGCGCGGCTACGACACCGCGCCGGCACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAACATAATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTACAGGACGCCCCCAGGGGCGCTGCTAGGGGTGTCTGCTCAGATATG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 4513 | GenBank | NZ_CP117582 |
Plasmid name | pEA47_2 | Incompatibility group | ColRNAI |
Plasmid size | 2720 bp | Coordinate of oriT [Strand] | 659..941 [+] |
Host baterium | Escherichia albertii strain BIA_47 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |