Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104071
Name   oriT_pEA16-3_2 in_silico
Organism   Escherichia albertii strain BIA_16-3
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP117649 (883..942 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pEA16-3_2
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4510 GenBank   NZ_CP117649
Plasmid name   pEA16-3_2 Incompatibility group   ColRNAI
Plasmid size   5055 bp Coordinate of oriT [Strand]   883..942 [+]
Host baterium   Escherichia albertii strain BIA_16-3

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -