Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104060
Name   oriT_pKP49 in_silico
Organism   Klebsiella pneumoniae strain KP49
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OL804392 (59532..59630 [-], 99 nt)
oriT length   99 nt
IRs (inverted repeats)      77..82, 89..94  (AAAAAA..TTTTTT)
 77..82, 88..93  (AAAAAA..TTTTTT)
 31..38, 41..48  (AGCGTGAT..ATCACGCT)
 17..23, 35..41  (TAAATCA..TGATTTA)
Location of nic site      59..60
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 99 nt

>oriT_pKP49
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4499 GenBank   NZ_OL804392
Plasmid name   pKP49 Incompatibility group   IncR
Plasmid size   83674 bp Coordinate of oriT [Strand]   59532..59630 [-]
Host baterium   Klebsiella pneumoniae strain KP49

Cargo genes


Drug resistance gene   aph(3')-Ia, mph(A), sul1, qacE, ARR-3, catB3, blaOXA-1, aac(6')-Ib-cr, mcr-8, rmtB, blaTEM-1B, aac(3)-IId
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -