Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104053 |
| Name | oriT_p123_2  |
| Organism | Salmonella enterica subsp. enterica strain 123 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP117186 (2064..2123 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | 5..12, 16..23 (TTCAGGGC..GCCCTGAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_p123_2
GGGTTTCAGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCAGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4492 | GenBank | NZ_CP117186 |
| Plasmid name | p123_2 | Incompatibility group | Col440I |
| Plasmid size | 2525 bp | Coordinate of oriT [Strand] | 2064..2123 [+] |
| Host baterium | Salmonella enterica subsp. enterica strain 123 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |