Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104039 |
| Name | oriT_kpn-241|unnamed3 |
| Organism | Klebsiella pneumoniae strain kpn-241 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP053668 (19900..19948 [+], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_kpn-241|unnamed3
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 13789..20506
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| HPK15_RS26570 (HPK15_26975) | 10106..10378 | + | 273 | Protein_13 | IS1 family transposase | - |
| HPK15_RS26575 (HPK15_26980) | 10395..11294 | - | 900 | Protein_14 | TraC family protein | - |
| HPK15_RS26580 (HPK15_26985) | 11366..11764 | - | 399 | WP_013609531 | hypothetical protein | - |
| HPK15_RS26585 (HPK15_26990) | 12140..12544 | - | 405 | WP_004197817 | hypothetical protein | - |
| HPK15_RS26590 (HPK15_26995) | 12611..12922 | - | 312 | WP_015344986 | hypothetical protein | - |
| HPK15_RS26595 (HPK15_27000) | 12923..13141 | - | 219 | WP_015344987 | hypothetical protein | - |
| HPK15_RS26600 (HPK15_27005) | 13247..13657 | - | 411 | WP_009309869 | hypothetical protein | - |
| HPK15_RS26605 (HPK15_27010) | 13789..14373 | - | 585 | WP_013023822 | type IV conjugative transfer system lipoprotein TraV | traV |
| HPK15_RS26610 (HPK15_27015) | 14487..15911 | - | 1425 | WP_004194260 | F-type conjugal transfer pilus assembly protein TraB | traB |
| HPK15_RS26615 (HPK15_27020) | 15911..16651 | - | 741 | WP_013023821 | type-F conjugative transfer system secretin TraK | traK |
| HPK15_RS26620 (HPK15_27025) | 16638..17204 | - | 567 | WP_004144423 | type IV conjugative transfer system protein TraE | traE |
| HPK15_RS26625 (HPK15_27030) | 17224..17529 | - | 306 | WP_004144424 | type IV conjugative transfer system protein TraL | traL |
| HPK15_RS26630 (HPK15_27035) | 17543..17911 | - | 369 | WP_004194426 | type IV conjugative transfer system pilin TraA | - |
| HPK15_RS26635 (HPK15_27045) | 18266..18967 | - | 702 | WP_004194113 | hypothetical protein | - |
| HPK15_RS26640 (HPK15_27050) | 19197..19589 | - | 393 | WP_004194114 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| HPK15_RS26645 (HPK15_27055) | 20021..20506 | + | 486 | WP_001568108 | transglycosylase SLT domain-containing protein | virB1 |
| HPK15_RS26650 (HPK15_27060) | 20539..20814 | - | 276 | WP_141436778 | DUF5983 family protein | - |
| HPK15_RS26655 (HPK15_27065) | 20856..22427 | - | 1572 | WP_000381395 | IS66-like element ISCro1 family transposase | - |
| HPK15_RS26660 (HPK15_27070) | 22447..22794 | - | 348 | WP_000624622 | IS66 family insertion sequence element accessory protein TnpB | - |
| HPK15_RS26665 (HPK15_27075) | 22794..23471 | - | 678 | WP_001299364 | IS66-like element accessory protein TnpA | - |
| HPK15_RS26670 (HPK15_27080) | 23608..24429 | - | 822 | WP_004152492 | DUF932 domain-containing protein | - |
Region 2: 79007..90813
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| HPK15_RS26995 (HPK15_27465) | 74296..75867 | + | 1572 | WP_000381395 | IS66-like element ISCro1 family transposase | - |
| HPK15_RS27000 (HPK15_27470) | 75898..76545 | - | 648 | Protein_100 | TraD N-terminal domain-containing protein | - |
| HPK15_RS27005 (HPK15_27475) | 76672..77361 | - | 690 | WP_013023831 | hypothetical protein | - |
| HPK15_RS27010 (HPK15_27480) | 77554..78285 | - | 732 | WP_013023830 | conjugal transfer complement resistance protein TraT | - |
| HPK15_RS27015 (HPK15_27485) | 78471..79004 | - | 534 | WP_014343486 | conjugal transfer protein TraS | - |
| HPK15_RS27020 (HPK15_27490) | 79007..81856 | - | 2850 | WP_013609534 | conjugal transfer mating-pair stabilization protein TraG | traG |
| HPK15_RS27025 (HPK15_27495) | 81856..83235 | - | 1380 | WP_014343487 | conjugal transfer pilus assembly protein TraH | traH |
| HPK15_RS27030 (HPK15_27500) | 83213..83656 | - | 444 | WP_013023828 | F-type conjugal transfer protein TrbF | - |
| HPK15_RS27035 (HPK15_27505) | 83702..84259 | - | 558 | WP_013214031 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| HPK15_RS27040 (HPK15_27510) | 84231..84470 | - | 240 | WP_004144400 | type-F conjugative transfer system pilin chaperone TraQ | - |
| HPK15_RS27045 (HPK15_27515) | 84481..85233 | - | 753 | WP_004152677 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| HPK15_RS27050 (HPK15_27520) | 85254..85580 | - | 327 | WP_004152676 | hypothetical protein | - |
| HPK15_RS27055 (HPK15_27525) | 85593..85841 | - | 249 | WP_004152675 | hypothetical protein | - |
| HPK15_RS27060 (HPK15_27530) | 85819..86073 | - | 255 | WP_004152674 | conjugal transfer protein TrbE | - |
| HPK15_RS27065 (HPK15_27535) | 86105..88060 | - | 1956 | WP_013023827 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| HPK15_RS27070 (HPK15_27540) | 88119..88757 | - | 639 | WP_011977786 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| HPK15_RS27075 (HPK15_27545) | 88770..89759 | - | 990 | WP_009309872 | conjugal transfer pilus assembly protein TraU | traU |
| HPK15_RS27080 (HPK15_27550) | 89756..90145 | - | 390 | WP_004194992 | hypothetical protein | - |
| HPK15_RS27085 (HPK15_27555) | 90187..90813 | - | 627 | WP_009309871 | type-F conjugative transfer system protein TraW | traW |
| HPK15_RS27090 (HPK15_27560) | 90813..91202 | - | 390 | WP_004197815 | type-F conjugative transfer system protein TrbI | - |
| HPK15_RS27095 (HPK15_27565) | 91202..92947 | - | 1746 | Protein_119 | type IV secretion system protein TraC | - |
| HPK15_RS27105 (HPK15_27575) | 93717..93911 | + | 195 | Protein_121 | transposase | - |
| HPK15_RS27110 (HPK15_27580) | 94246..95121 | + | 876 | WP_000239590 | extended-spectrum class A beta-lactamase CTX-M-15 | - |
| HPK15_RS27115 (HPK15_27585) | 95168..95644 | - | 477 | WP_013023839 | WbuC family cupin fold metalloprotein | - |
Host bacterium
| ID | 4478 | GenBank | NZ_CP053668 |
| Plasmid name | kpn-241|unnamed3 | Incompatibility group | - |
| Plasmid size | 97666 bp | Coordinate of oriT [Strand] | 19900..19948 [+] |
| Host baterium | Klebsiella pneumoniae strain kpn-241 |
Cargo genes
| Drug resistance gene | blaIMP-4, blaCTX-M-15, blaTEM-1B |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |