Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104025 |
| Name | oriT_AUSMDU00007171|P01  |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00007171 isolate AUSMDU00007171 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_OU015343 (2899..2956 [-], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_AUSMDU00007171|P01
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4465 | GenBank | NZ_OU015343 |
| Plasmid name | AUSMDU00007171|P01 | Incompatibility group | Col440I |
| Plasmid size | 4251 bp | Coordinate of oriT [Strand] | 2899..2956 [-] |
| Host baterium | Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00007171 isolate AUSMDU00007171 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |