Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104025
Name   oriT_AUSMDU00007171|P01 in_silico
Organism   Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00007171 isolate AUSMDU00007171
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OU015343 (2899..2956 [-], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_AUSMDU00007171|P01
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4465 GenBank   NZ_OU015343
Plasmid name   AUSMDU00007171|P01 Incompatibility group   Col440I
Plasmid size   4251 bp Coordinate of oriT [Strand]   2899..2956 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00007171 isolate AUSMDU00007171

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -