Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104007 |
| Name | oriT_pHG1  |
| Organism | Levilactobacillus zymae strain GU240 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MT436440 (862..899 [+], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 1..6, 20..25 (ACACCA..TGGTGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_pHG1
ACACCATCAATTTTAATTGTGGTGTGTAAGTGCGCATT
ACACCATCAATTTTAATTGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4447 | GenBank | NZ_MT436440 |
| Plasmid name | pHG1 | Incompatibility group | - |
| Plasmid size | 1356 bp | Coordinate of oriT [Strand] | 862..899 [+] |
| Host baterium | Levilactobacillus zymae strain GU240 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |