Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   103942
Name   oriT_pSE95-3 in_silico
Organism   Salmonella enterica subsp. enterica serovar Enteritidis strain SE95
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP050719 (4387..4546 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_pSE95-3
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4382 GenBank   NZ_CP050719
Plasmid name   pSE95-3 Incompatibility group   IncQ1
Plasmid size   7264 bp Coordinate of oriT [Strand]   4387..4546 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Enteritidis strain SE95

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -