Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103917 |
| Name | oriT_p16-6397.2  |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP040323 (3488..3545 [-], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_p16-6397.2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4357 | GenBank | NZ_CP040323 |
| Plasmid name | p16-6397.2 | Incompatibility group | ColRNAI |
| Plasmid size | 5491 bp | Coordinate of oriT [Strand] | 3488..3545 [-] |
| Host baterium | Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014879 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |