Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103909 |
| Name | oriT_pHUV05-01  |
| Organism | Staphylococcus aureus strain HUV05 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP007677 (16049..16238 [+], 190 nt) |
| oriT length | 190 nt |
| IRs (inverted repeats) | 150..157, 162..169 (CTATCATT..AATGATAG) 133..139, 143..149 (GTCTGGC..GCCAGAC) 71..77, 89..95 (AAAAAGC..GCTTTTT) 64..70, 78..84 (GTGTCAC..GTGACAC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 190 nt
>oriT_pHUV05-01
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCTCAAAACTGTGACAACCGCAATATATTGTGTCACAAAAAGCGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTAAGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCTCAAAACTGTGACAACCGCAATATATTGTGTCACAAAAAGCGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTAAGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4349 | GenBank | NZ_CP007677 |
| Plasmid name | pHUV05-01 | Incompatibility group | - |
| Plasmid size | 20185 bp | Coordinate of oriT [Strand] | 16049..16238 [+] |
| Host baterium | Staphylococcus aureus strain HUV05 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |