Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103903 |
| Name | oriT_DO|2  |
| Organism | Enterococcus faecium DO |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_017962 (51874..51974 [+], 101 nt) |
| oriT length | 101 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 101 nt
>oriT_DO|2
TCATCTGCCGAAACTTTGAATATGAGTGTGCCGACTTTCGTTAAGAAAAAGGCACAAGGCAGTCGATTGGTAGCGCCCAAATTAGATAAAGAGACGCGACA
TCATCTGCCGAAACTTTGAATATGAGTGTGCCGACTTTCGTTAAGAAAAAGGCACAAGGCAGTCGATTGGTAGCGCCCAAATTAGATAAAGAGACGCGACA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4343 | GenBank | NC_017962 |
| Plasmid name | DO|2 | Incompatibility group | - |
| Plasmid size | 66247 bp | Coordinate of oriT [Strand] | 51874..51974 [+] |
| Host baterium | Enterococcus faecium DO |
Cargo genes
| Drug resistance gene | aph(3')-III, ant(6)-Ia, erm(B), cat(pC233) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA9, AcrIIA21 |