Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 103900
• Name: oriT_pPCY1
• Organism: Yersinia pestis D106004
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NC_017156 (3206..3265 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pPCY1
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 4340
• GenBank: NC_017156
• Plasmid name: pPCY1
• Incompatibility group: ColRNAI
• Plasmid size: 9611 bp
• Coordinate of oriT [Strand]: 3206..3265 [+]
• Host baterium: Yersinia pestis D106004

Cargo genes

• Drug resistance gene: -
• Virulence gene: pla
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -