Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   103900
Name   oriT_pPCY1 in_silico
Organism   Yersinia pestis D106004
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_017156 (3206..3265 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pPCY1
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4340 GenBank   NC_017156
Plasmid name   pPCY1 Incompatibility group   ColRNAI
Plasmid size   9611 bp Coordinate of oriT [Strand]   3206..3265 [+]
Host baterium   Yersinia pestis D106004

Cargo genes


Drug resistance gene   -
Virulence gene   pla
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -