Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103874 |
| Name | oriT1_p3589  |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain B3589 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP034969 ( 3184..3241 [+], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT1_p3589
GGGTTTCGGGGCACAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTACAGTGGCT
GGGTTTCGGGGCACAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTACAGTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4314 | GenBank | NZ_CP034969 |
| Plasmid name | p3589 | Incompatibility group | Col440I |
| Plasmid size | 4791 bp | Coordinate of oriT [Strand] | 704..761 [+]; 3184..3241 [+] |
| Host baterium | Salmonella enterica subsp. enterica serovar Typhimurium strain B3589 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |