Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   103874
Name   oriT1_p3589 in_silico
Organism   Salmonella enterica subsp. enterica serovar Typhimurium strain B3589
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP034969 ( 3184..3241 [+], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT1_p3589
GGGTTTCGGGGCACAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTACAGTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4314 GenBank   NZ_CP034969
Plasmid name   p3589 Incompatibility group   Col440I
Plasmid size   4791 bp Coordinate of oriT [Strand]   704..761 [+]; 3184..3241 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Typhimurium strain B3589

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -