Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   103864
Name   oriT_p11k in_silico
Organism   Salmonella enterica subsp. enterica serovar Typhimurium strain BL10
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP025338 (749..908 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_p11k
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4304 GenBank   NZ_CP025338
Plasmid name   p11k Incompatibility group   IncQ1
Plasmid size   11080 bp Coordinate of oriT [Strand]   749..908 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Typhimurium strain BL10

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -