Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   103862
Name   oriT_p3.8k in_silico
Organism   Salmonella enterica subsp. enterica serovar Typhimurium strain BL10
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP025336 (403..462 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p3.8k
GGGTGTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4302 GenBank   NZ_CP025336
Plasmid name   p3.8k Incompatibility group   Col440I
Plasmid size   3830 bp Coordinate of oriT [Strand]   403..462 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Typhimurium strain BL10

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -