Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103829 |
| Name | oriT1_pR48_6  |
| Organism | Klebsiella pneumoniae strain Nord5-1_R48 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP091589 ( 2565..2615 [-], 51 nt) |
| oriT length | 51 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 51 nt
>oriT1_pR48_6
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4269 | GenBank | NZ_CP091589 |
| Plasmid name | pR48_6 | Incompatibility group | Col440I |
| Plasmid size | 7619 bp | Coordinate of oriT [Strand] | 6732..6782 [-]; 2565..2615 [-] |
| Host baterium | Klebsiella pneumoniae strain Nord5-1_R48 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |