Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   103828
Name   oriT_pMV-v4-SK2-O-b in_silico
Organism   Klebsiella pneumoniae strain MV-v4-SK2-O
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP085865 (5644..5703 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pMV-v4-SK2-O-b
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4268 GenBank   NZ_CP085865
Plasmid name   pMV-v4-SK2-O-b Incompatibility group   ColRNAI
Plasmid size   5891 bp Coordinate of oriT [Strand]   5644..5703 [+]
Host baterium   Klebsiella pneumoniae strain MV-v4-SK2-O

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -