Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103826 |
| Name | oriT1_pR85_4 |
| Organism | Klebsiella pneumoniae strain Nord9_R85 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP091587 ( 1657..1715 [-], 59 nt) |
| oriT length | 59 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 59 nt
>oriT1_pR85_4
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4266 | GenBank | NZ_CP091587 |
| Plasmid name | pR85_4 | Incompatibility group | Col440I |
| Plasmid size | 7742 bp | Coordinate of oriT [Strand] | 5949..6007 [-]; 1657..1715 [-] |
| Host baterium | Klebsiella pneumoniae strain Nord9_R85 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |