Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103825 |
| Name | oriT1_pR85_3  |
| Organism | Klebsiella pneumoniae strain Nord9_R85 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP091586 ( 11225..11384 [+], 160 nt) |
| oriT length | 160 nt |
| IRs (inverted repeats) | 39..44, 48..53 (CCCTAC..GTAGGG) 6..12, 16..22 (GTTTCTC..GAGAAAC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GTGCGCCCTC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 160 nt
>oriT1_pR85_3
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4265 | GenBank | NZ_CP091586 |
| Plasmid name | pR85_3 | Incompatibility group | IncQ1 |
| Plasmid size | 20868 bp | Coordinate of oriT [Strand] | 277..436 [+]; 11225..11384 [+] |
| Host baterium | Klebsiella pneumoniae strain Nord9_R85 |
Cargo genes
| Drug resistance gene | aph(3')-VIa, blaKPC-2 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |