Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103822 |
| Name | oriT_pR886_3  |
| Organism | Klebsiella pneumoniae strain Nord77_R886 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP091600 (12753..12847 [-], 95 nt) |
| oriT length | 95 nt |
| IRs (inverted repeats) | 73..78, 85..90 (AAAAAA..TTTTTT) 73..78, 84..89 (AAAAAA..TTTTTT) 27..34, 37..44 (AGCGTGAT..ATCACGCT) 13..19, 31..37 (TAAATCA..TGATTTA) |
| Location of nic site | 55..56 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 95 nt
>oriT_pR886_3
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4262 | GenBank | NZ_CP091600 |
| Plasmid name | pR886_3 | Incompatibility group | IncFIA |
| Plasmid size | 69630 bp | Coordinate of oriT [Strand] | 12753..12847 [-] |
| Host baterium | Klebsiella pneumoniae strain Nord77_R886 |
Cargo genes
| Drug resistance gene | blaSHV-187, ARR-3, ere(A), ant(3'')-Ia, cmlA1, qacE, sul1, aph(6)-Id, aph(3'')-Ib, sul2, blaTEM-1A, blaOXA-9, aac(6')-Ib, blaCTX-M-15, aac(3)-IId |
| Virulence gene | - |
| Metal resistance gene | merE, merD, merA, merC, merP, merT, merR |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |