Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103819 |
| Name | oriT_pMV-u1-SK2-O-c  |
| Organism | Klebsiella pneumoniae strain MV-u1-SK2-O |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP085869 (1715..1774 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pMV-u1-SK2-O-c
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4259 | GenBank | NZ_CP085869 |
| Plasmid name | pMV-u1-SK2-O-c | Incompatibility group | Col440II |
| Plasmid size | 4667 bp | Coordinate of oriT [Strand] | 1715..1774 [+] |
| Host baterium | Klebsiella pneumoniae strain MV-u1-SK2-O |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |