Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103807 |
| Name | oriT_pYU39_2.7  |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP011435 (2209..2283 [+], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | 12..17, 20..25 (GCCCTG..CAGGGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_pYU39_2.7
GTCGGGGCAAAGCCCTGACCAGGGCAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
GTCGGGGCAAAGCCCTGACCAGGGCAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4247 | GenBank | NZ_CP011435 |
| Plasmid name | pYU39_2.7 | Incompatibility group | ColRNAI |
| Plasmid size | 2677 bp | Coordinate of oriT [Strand] | 2209..2283 [+] |
| Host baterium | Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |