Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103780 |
| Name | oriT_pC10  |
| Organism | Enterococcus faecalis strain C10 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MK861852 (26517..26554 [+], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 1..6, 10..15 (CTTTAC..GTAAAG) |
| Location of nic site | 24..25 |
| Conserved sequence flanking the nic site |
GTGTGTTATA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_pC10
CTTTACGAAGTAAAGTATAGTGTGTTATACTTTACATG
CTTTACGAAGTAAAGTATAGTGTGTTATACTTTACATG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4220 | GenBank | NZ_MK861852 |
| Plasmid name | pC10 | Incompatibility group | - |
| Plasmid size | 37990 bp | Coordinate of oriT [Strand] | 26517..26554 [+] |
| Host baterium | Enterococcus faecalis strain C10 |
Cargo genes
| Drug resistance gene | poxtA, fexB, tet(M), tet(L), cat |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21, AcrIIA5 |