Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103766 |
| Name | oriT_pPZZ84  |
| Organism | Bacillus pumilus |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_013534 (3308..3330 [+], 23 nt) |
| oriT length | 23 nt |
| IRs (inverted repeats) | 1..7, 17..23 (ACCCCCC..GGGGGGT) 3..8, 17..22 (CCCCCC..GGGGGG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 23 nt
>oriT_pPZZ84
ACCCCCCCAGCTAACAGGGGGGT
ACCCCCCCAGCTAACAGGGGGGT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4206 | GenBank | NC_013534 |
| Plasmid name | pPZZ84 | Incompatibility group | - |
| Plasmid size | 6817 bp | Coordinate of oriT [Strand] | 3308..3330 [+] |
| Host baterium | Bacillus pumilus |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |