Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103758 |
| Name | oriT_pXY3 |
| Organism | Lactiplantibacillus plantarum |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_013789 (1454..1491 [+], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 1..6, 20..25 (ACACCA..TGGTGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_pXY3
ACACCATCAATTTTAATTGTGGTGTGTAAGTGCGCATT
ACACCATCAATTTTAATTGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4198 | GenBank | NC_013789 |
| Plasmid name | pXY3 | Incompatibility group | - |
| Plasmid size | 2968 bp | Coordinate of oriT [Strand] | 1454..1491 [+] |
| Host baterium | Lactiplantibacillus plantarum |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |