Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 103743 |
Name | oriT_pRK10 |
Organism | Serratia marcescens |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NC_010796 (2020..2079 [-], 60 nt) |
oriT length | 60 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pRK10
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 4183 | GenBank | NC_010796 |
Plasmid name | pRK10 | Incompatibility group | Col440I |
Plasmid size | 4241 bp | Coordinate of oriT [Strand] | 2020..2079 [-] |
Host baterium | Serratia marcescens |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |