Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103736 |
| Name | oriT_pAR141  |
| Organism | Lactococcus lactis subsp. lactis |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_013783 (1562..1594 [+], 33 nt) |
| oriT length | 33 nt |
| IRs (inverted repeats) | 1..7, 19..25 (ACACCAC..GTGGTGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 33 nt
>oriT_pAR141
ACACCACCCAATTTTGGAGTGGTGTGTAAGTGC
ACACCACCCAATTTTGGAGTGGTGTGTAAGTGC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4176 | GenBank | NC_013783 |
| Plasmid name | pAR141 | Incompatibility group | - |
| Plasmid size | 1594 bp | Coordinate of oriT [Strand] | 1562..1594 [+] |
| Host baterium | Lactococcus lactis subsp. lactis |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |