Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103733 |
| Name | oriT_pJB01  |
| Organism | Enterococcus faecium |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_006427 (2205..2235 [+], 31 nt) |
| oriT length | 31 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 31 nt
>oriT_pJB01
ACCACCCAATTTTGGAGTGGTGTGTAAGTGC
ACCACCCAATTTTGGAGTGGTGTGTAAGTGC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4173 | GenBank | NC_006427 |
| Plasmid name | pJB01 | Incompatibility group | - |
| Plasmid size | 2235 bp | Coordinate of oriT [Strand] | 2205..2235 [+] |
| Host baterium | Enterococcus faecium |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |