Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   103733
Name   oriT_pJB01 in_silico
Organism   Enterococcus faecium
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_006427 (2205..2235 [+], 31 nt)
oriT length   31 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 31 nt

>oriT_pJB01
ACCACCCAATTTTGGAGTGGTGTGTAAGTGC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4173 GenBank   NC_006427
Plasmid name   pJB01 Incompatibility group   -
Plasmid size   2235 bp Coordinate of oriT [Strand]   2205..2235 [+]
Host baterium   Enterococcus faecium

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -