Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103689 |
| Name | oriT_p1_015247  |
| Organism | Klebsiella pneumoniae strain WCHKP015247 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP046959 (5675..5724 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_p1_015247
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 5117..25386
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| C6M24_RS27430 (C6M24_26970) | 273..590 | + | 318 | WP_014343505 | hypothetical protein | - |
| C6M24_RS27435 (C6M24_26975) | 1431..1787 | + | 357 | WP_014343501 | hypothetical protein | - |
| C6M24_RS27440 (C6M24_26980) | 1848..2060 | + | 213 | WP_014343500 | hypothetical protein | - |
| C6M24_RS27445 (C6M24_26985) | 2071..2295 | + | 225 | WP_014343499 | hypothetical protein | - |
| C6M24_RS27450 (C6M24_26990) | 2376..2696 | + | 321 | WP_014343498 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| C6M24_RS27455 (C6M24_26995) | 2686..2964 | + | 279 | WP_004152721 | helix-turn-helix transcriptional regulator | - |
| C6M24_RS27460 (C6M24_27000) | 2968..3072 | + | 105 | Protein_7 | transcriptional regulator | - |
| C6M24_RS27465 (C6M24_27005) | 3901..4722 | + | 822 | WP_004152492 | DUF932 domain-containing protein | - |
| C6M24_RS27470 (C6M24_27010) | 4755..5084 | + | 330 | WP_013214015 | DUF5983 family protein | - |
| C6M24_RS27475 (C6M24_27015) | 5117..5602 | - | 486 | WP_014343495 | transglycosylase SLT domain-containing protein | virB1 |
| C6M24_RS27480 (C6M24_27020) | 5993..6409 | + | 417 | WP_014343494 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| C6M24_RS27485 (C6M24_27025) | 6609..7346 | + | 738 | WP_013214018 | conjugal transfer protein TrbJ | - |
| C6M24_RS27490 (C6M24_27030) | 7461..7667 | + | 207 | WP_171773970 | TraY domain-containing protein | - |
| C6M24_RS27495 (C6M24_27035) | 7729..8097 | + | 369 | WP_004194426 | type IV conjugative transfer system pilin TraA | - |
| C6M24_RS27500 (C6M24_27040) | 8111..8416 | + | 306 | WP_004144424 | type IV conjugative transfer system protein TraL | traL |
| C6M24_RS27505 (C6M24_27045) | 8436..8801 | + | 366 | Protein_16 | type IV conjugative transfer system protein TraE | - |
| C6M24_RS27510 (C6M24_27050) | 8856..9560 | - | 705 | WP_001067855 | IS6-like element IS26 family transposase | - |
| C6M24_RS27515 (C6M24_27055) | 9625..10215 | + | 591 | Protein_18 | transposase | - |
| C6M24_RS27520 (C6M24_27060) | 10599..13604 | + | 3006 | WP_123766424 | Tn3-like element Tn3 family transposase | - |
| C6M24_RS28145 | 13902..14354 | + | 453 | WP_001749956 | DUF6710 family protein | - |
| C6M24_RS27530 (C6M24_27070) | 14528..15061 | - | 534 | WP_000792636 | phospholipase D family protein | - |
| C6M24_RS27535 (C6M24_27075) | 15061..16056 | - | 996 | WP_000128596 | ATPase, T2SS/T4P/T4SS family | virB11 |
| C6M24_RS27540 (C6M24_27080) | 16098..17258 | - | 1161 | WP_000101710 | type IV secretion system protein VirB10 | virB10 |
| C6M24_RS27545 (C6M24_27085) | 17258..18142 | - | 885 | WP_000735066 | TrbG/VirB9 family P-type conjugative transfer protein | virB9 |
| C6M24_RS27550 (C6M24_27090) | 18153..18851 | - | 699 | WP_000646594 | type IV secretion system protein | virB8 |
| C6M24_RS28150 | 18841..18999 | - | 159 | WP_012561180 | hypothetical protein | - |
| C6M24_RS27555 (C6M24_27095) | 19070..20110 | - | 1041 | WP_001749958 | type IV secretion system protein | virB6 |
| C6M24_RS27560 (C6M24_27100) | 20126..20353 | - | 228 | WP_001749959 | IncN-type entry exclusion lipoprotein EexN | - |
| C6M24_RS27565 (C6M24_27105) | 20361..21074 | - | 714 | WP_001749960 | type IV secretion system protein | virB5 |
| C6M24_RS27570 (C6M24_27110) | 21092..23692 | - | 2601 | WP_001749961 | VirB4 family type IV secretion/conjugal transfer ATPase | virb4 |
| C6M24_RS27575 (C6M24_27115) | 23692..24009 | - | 318 | WP_000496058 | VirB3 family type IV secretion system protein | virB3 |
| C6M24_RS27580 (C6M24_27120) | 24059..24352 | - | 294 | WP_001749962 | hypothetical protein | virB2 |
| C6M24_RS27585 (C6M24_27125) | 24362..24643 | - | 282 | WP_000440698 | transcriptional repressor KorA | - |
| C6M24_RS27590 (C6M24_27130) | 24652..25386 | - | 735 | WP_001749963 | lytic transglycosylase domain-containing protein | virB1 |
| C6M24_RS27595 (C6M24_27135) | 25495..25800 | + | 306 | WP_000960954 | H-NS family nucleoid-associated regulatory protein | - |
| C6M24_RS27600 (C6M24_27140) | 25816..26160 | + | 345 | WP_001749964 | hypothetical protein | - |
| C6M24_RS27605 (C6M24_27145) | 26157..26471 | + | 315 | WP_001749965 | TrbM/KikA/MpfK family conjugal transfer protein | - |
| C6M24_RS27610 (C6M24_27150) | 26585..26818 | + | 234 | WP_001191790 | hypothetical protein | - |
| C6M24_RS27615 (C6M24_27155) | 26868..27515 | + | 648 | WP_015344958 | restriction endonuclease | - |
| C6M24_RS27620 (C6M24_27160) | 27520..27726 | + | 207 | WP_001749967 | hypothetical protein | - |
| C6M24_RS27625 (C6M24_27165) | 27737..28009 | - | 273 | Protein_41 | IS1 family transposase | - |
| C6M24_RS27630 (C6M24_27170) | 28108..29541 | + | 1434 | WP_001288432 | DNA cytosine methyltransferase | - |
Host bacterium
| ID | 4132 | GenBank | NZ_CP046959 |
| Plasmid name | p1_015247 | Incompatibility group | IncR |
| Plasmid size | 80768 bp | Coordinate of oriT [Strand] | 5675..5724 [-] |
| Host baterium | Klebsiella pneumoniae strain WCHKP015247 |
Cargo genes
| Drug resistance gene | sul1, qacE, aadA16, dfrA27, ARR-3, aac(6')-Ib-cr |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |