Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 103631
• Name: oriT_p21OH12SH02A-5
• Organism: Citrobacter sp. 21OH12SH02A-Citro
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP114806 (1716..1775 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_p21OH12SH02A-5
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 4074
• GenBank: NZ_CP114806
• Plasmid name: p21OH12SH02A-5
• Incompatibility group: ColRNAI
• Plasmid size: 5775 bp
• Coordinate of oriT [Strand]: 1716..1775 [-]
• Host baterium: Citrobacter sp. 21OH12SH02A-Citro

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -