Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103630 |
| Name | oriT_pKpUC43_162k |
| Organism | Klebsiella pneumoniae subsp. pneumoniae strain 43UC01 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP115933 (4289..4338 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pKpUC43_162k
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTCATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTCATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 3731..23399
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DLD89_RS27090 (DLD89_27085) | 151..363 | + | 213 | WP_004152718 | hypothetical protein | - |
| DLD89_RS27095 (DLD89_27090) | 374..598 | + | 225 | WP_004152719 | hypothetical protein | - |
| DLD89_RS27100 (DLD89_27095) | 679..999 | + | 321 | WP_004152720 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| DLD89_RS27105 (DLD89_27100) | 989..1267 | + | 279 | WP_004152721 | helix-turn-helix transcriptional regulator | - |
| DLD89_RS27110 (DLD89_27105) | 1268..1681 | + | 414 | WP_004152722 | helix-turn-helix domain-containing protein | - |
| DLD89_RS27115 (DLD89_27110) | 2515..3336 | + | 822 | WP_004178064 | DUF932 domain-containing protein | - |
| DLD89_RS27120 (DLD89_27115) | 3369..3698 | + | 330 | WP_011977736 | DUF5983 family protein | - |
| DLD89_RS27125 (DLD89_27120) | 3731..4216 | - | 486 | WP_004178063 | transglycosylase SLT domain-containing protein | virB1 |
| DLD89_RS27130 (DLD89_27125) | 4650..5042 | + | 393 | WP_004178062 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| DLD89_RS27135 (DLD89_27130) | 5256..5951 | + | 696 | WP_004178061 | transcriptional regulator TraJ family protein | - |
| DLD89_RS27140 (DLD89_27135) | 6035..6406 | + | 372 | WP_004208838 | TraY domain-containing protein | - |
| DLD89_RS27145 (DLD89_27140) | 6460..6828 | + | 369 | WP_004178060 | type IV conjugative transfer system pilin TraA | - |
| DLD89_RS27150 (DLD89_27145) | 6842..7147 | + | 306 | WP_004178059 | type IV conjugative transfer system protein TraL | traL |
| DLD89_RS27155 (DLD89_27150) | 7167..7733 | + | 567 | WP_004152602 | type IV conjugative transfer system protein TraE | traE |
| DLD89_RS27160 (DLD89_27155) | 7720..8460 | + | 741 | WP_004152601 | type-F conjugative transfer system secretin TraK | traK |
| DLD89_RS27165 (DLD89_27160) | 8460..9884 | + | 1425 | WP_004152600 | F-type conjugal transfer pilus assembly protein TraB | traB |
| DLD89_RS27170 (DLD89_27165) | 9877..10473 | + | 597 | WP_004152599 | conjugal transfer pilus-stabilizing protein TraP | - |
| DLD89_RS27175 (DLD89_27170) | 10496..11065 | + | 570 | WP_004152598 | type IV conjugative transfer system lipoprotein TraV | traV |
| DLD89_RS27180 (DLD89_27175) | 11197..11607 | + | 411 | WP_004152597 | lipase chaperone | - |
| DLD89_RS27185 (DLD89_27180) | 11612..11902 | + | 291 | WP_004152596 | hypothetical protein | - |
| DLD89_RS27190 (DLD89_27185) | 11926..12144 | + | 219 | WP_004171484 | hypothetical protein | - |
| DLD89_RS27195 (DLD89_27190) | 12145..12462 | + | 318 | WP_004152595 | hypothetical protein | - |
| DLD89_RS27200 (DLD89_27195) | 12529..12933 | + | 405 | WP_004152594 | hypothetical protein | - |
| DLD89_RS27205 (DLD89_27200) | 13229..13627 | + | 399 | WP_004153071 | hypothetical protein | - |
| DLD89_RS27210 (DLD89_27205) | 13699..16338 | + | 2640 | WP_004152592 | type IV secretion system protein TraC | virb4 |
| DLD89_RS27215 (DLD89_27210) | 16338..16727 | + | 390 | WP_004152591 | type-F conjugative transfer system protein TrbI | - |
| DLD89_RS27220 (DLD89_27215) | 16727..17353 | + | 627 | WP_004152590 | type-F conjugative transfer system protein TraW | traW |
| DLD89_RS27225 (DLD89_27220) | 17397..18356 | + | 960 | WP_015065634 | conjugal transfer pilus assembly protein TraU | traU |
| DLD89_RS27230 (DLD89_27225) | 18369..19007 | + | 639 | WP_004152682 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| DLD89_RS27235 (DLD89_27230) | 19055..21011 | + | 1957 | Protein_30 | type-F conjugative transfer system mating-pair stabilization protein TraN | - |
| DLD89_RS27240 (DLD89_27235) | 21043..21279 | + | 237 | WP_004152683 | conjugal transfer protein TrbE | - |
| DLD89_RS28300 | 21276..21461 | + | 186 | WP_004152684 | hypothetical protein | - |
| DLD89_RS27245 (DLD89_27240) | 21507..21833 | + | 327 | WP_004152685 | hypothetical protein | - |
| DLD89_RS27250 (DLD89_27245) | 21854..22605 | + | 752 | Protein_34 | type-F conjugative transfer system pilin assembly protein TraF | - |
| DLD89_RS27255 (DLD89_27250) | 22616..22855 | + | 240 | WP_004152687 | type-F conjugative transfer system pilin chaperone TraQ | - |
| DLD89_RS27260 (DLD89_27255) | 22827..23399 | + | 573 | WP_004152688 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| DLD89_RS27265 (DLD89_27260) | 23392..23819 | + | 428 | Protein_37 | conjugal transfer protein TrbF | - |
| DLD89_RS27270 (DLD89_27265) | 23806..25175 | + | 1370 | Protein_38 | conjugal transfer pilus assembly protein TraH | - |
| DLD89_RS27275 (DLD89_27270) | 25175..28023 | + | 2849 | Protein_39 | conjugal transfer mating-pair stabilization protein TraG | - |
Host bacterium
| ID | 4073 | GenBank | NZ_CP115933 |
| Plasmid name | pKpUC43_162k | Incompatibility group | IncFII |
| Plasmid size | 162490 bp | Coordinate of oriT [Strand] | 4289..4338 [-] |
| Host baterium | Klebsiella pneumoniae subsp. pneumoniae strain 43UC01 |
Cargo genes
| Drug resistance gene | catA1, dfrA12, aadA2, qacE, sul1, mph(A), aac(6')-Ib |
| Virulence gene | - |
| Metal resistance gene | fecE, fecD |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |