Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103629 |
| Name | oriT_pKpUC43_114k  |
| Organism | Klebsiella pneumoniae subsp. pneumoniae strain 43UC01 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP115931 (74654..74703 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pKpUC43_114k
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 74096..95446
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DLD89_RS26740 (DLD89_26735) | 69198..69548 | + | 351 | WP_004153414 | hypothetical protein | - |
| DLD89_RS26745 (DLD89_26740) | 70178..70531 | + | 354 | WP_004152748 | hypothetical protein | - |
| DLD89_RS26750 (DLD89_26745) | 70588..70935 | + | 348 | WP_004152749 | hypothetical protein | - |
| DLD89_RS26755 (DLD89_26750) | 71030..71176 | + | 147 | WP_004152750 | hypothetical protein | - |
| DLD89_RS26760 (DLD89_26755) | 71227..72060 | + | 834 | WP_004152751 | N-6 DNA methylase | - |
| DLD89_RS26765 (DLD89_26760) | 72880..73701 | + | 822 | WP_004152492 | DUF932 domain-containing protein | - |
| DLD89_RS26770 (DLD89_26765) | 73734..74063 | + | 330 | WP_011977736 | DUF5983 family protein | - |
| DLD89_RS26775 (DLD89_26770) | 74096..74581 | - | 486 | WP_001568108 | transglycosylase SLT domain-containing protein | virB1 |
| DLD89_RS26780 (DLD89_26775) | 75003..75401 | + | 399 | WP_004152493 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| DLD89_RS26785 (DLD89_26780) | 75575..76261 | + | 687 | WP_004152494 | transcriptional regulator TraJ family protein | - |
| DLD89_RS26790 (DLD89_26785) | 76340..76726 | + | 387 | WP_004152495 | TraY domain-containing protein | - |
| DLD89_RS26795 (DLD89_26790) | 76780..77148 | + | 369 | WP_004152496 | type IV conjugative transfer system pilin TraA | - |
| DLD89_RS26800 (DLD89_26795) | 77162..77467 | + | 306 | WP_004144424 | type IV conjugative transfer system protein TraL | traL |
| DLD89_RS26805 (DLD89_26800) | 77487..78053 | + | 567 | WP_004144423 | type IV conjugative transfer system protein TraE | traE |
| DLD89_RS26810 (DLD89_26805) | 78040..78780 | + | 741 | WP_004152497 | type-F conjugative transfer system secretin TraK | traK |
| DLD89_RS26815 (DLD89_26810) | 78780..80204 | + | 1425 | WP_004155033 | F-type conjugal transfer pilus assembly protein TraB | traB |
| DLD89_RS26820 (DLD89_26815) | 80318..80902 | + | 585 | WP_004161368 | type IV conjugative transfer system lipoprotein TraV | traV |
| DLD89_RS26825 (DLD89_26820) | 81034..81444 | + | 411 | WP_004152499 | hypothetical protein | - |
| DLD89_RS26830 (DLD89_26825) | 81550..81768 | + | 219 | WP_004152501 | hypothetical protein | - |
| DLD89_RS26835 (DLD89_26830) | 81769..82080 | + | 312 | WP_004152502 | hypothetical protein | - |
| DLD89_RS26840 (DLD89_26835) | 82147..82551 | + | 405 | WP_004152503 | hypothetical protein | - |
| DLD89_RS26845 (DLD89_26840) | 82594..82983 | + | 390 | WP_004153076 | hypothetical protein | - |
| DLD89_RS26850 (DLD89_26845) | 82991..83389 | + | 399 | WP_011977783 | hypothetical protein | - |
| DLD89_RS26855 (DLD89_26850) | 83461..86100 | + | 2640 | WP_004152505 | type IV secretion system protein TraC | virb4 |
| DLD89_RS26860 (DLD89_26855) | 86100..86489 | + | 390 | WP_004152506 | type-F conjugative transfer system protein TrbI | - |
| DLD89_RS26865 (DLD89_26860) | 86489..87115 | + | 627 | WP_004152507 | type-F conjugative transfer system protein TraW | traW |
| DLD89_RS26870 (DLD89_26865) | 87157..87546 | + | 390 | WP_004152508 | hypothetical protein | - |
| DLD89_RS26875 (DLD89_26870) | 87543..88532 | + | 990 | WP_011977785 | conjugal transfer pilus assembly protein TraU | traU |
| DLD89_RS26880 (DLD89_26875) | 88545..89183 | + | 639 | WP_004152672 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| DLD89_RS26885 (DLD89_26880) | 89242..91197 | + | 1956 | WP_004152673 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| DLD89_RS26890 (DLD89_26885) | 91229..91483 | + | 255 | WP_004152674 | conjugal transfer protein TrbE | - |
| DLD89_RS26895 (DLD89_26890) | 91461..91709 | + | 249 | WP_004152675 | hypothetical protein | - |
| DLD89_RS26900 (DLD89_26895) | 91722..92048 | + | 327 | WP_004152676 | hypothetical protein | - |
| DLD89_RS26905 (DLD89_26900) | 92069..92821 | + | 753 | WP_004152677 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| DLD89_RS26910 (DLD89_26905) | 92832..93071 | + | 240 | WP_004144400 | type-F conjugative transfer system pilin chaperone TraQ | - |
| DLD89_RS26915 (DLD89_26910) | 93043..93600 | + | 558 | WP_004152678 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| DLD89_RS26920 (DLD89_26915) | 93646..94089 | + | 444 | WP_004152679 | F-type conjugal transfer protein TrbF | - |
| DLD89_RS26925 (DLD89_26920) | 94067..95446 | + | 1380 | WP_004165169 | conjugal transfer pilus assembly protein TraH | traH |
| DLD89_RS26930 (DLD89_26925) | 95446..98292 | + | 2847 | Protein_119 | conjugal transfer mating-pair stabilization protein TraG | - |
| DLD89_RS26935 (DLD89_26930) | 98305..98853 | + | 549 | WP_004152623 | conjugal transfer entry exclusion protein TraS | - |
| DLD89_RS26940 (DLD89_26935) | 99149..99763 | + | 615 | Protein_121 | complement resistance protein TraT | - |
Host bacterium
| ID | 4072 | GenBank | NZ_CP115931 |
| Plasmid name | pKpUC43_114k | Incompatibility group | IncFIB |
| Plasmid size | 113594 bp | Coordinate of oriT [Strand] | 74654..74703 [-] |
| Host baterium | Klebsiella pneumoniae subsp. pneumoniae strain 43UC01 |
Cargo genes
| Drug resistance gene | blaKPC-2, blaTEM-1A |
| Virulence gene | - |
| Metal resistance gene | merE, merD, merA |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |