Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   103623
Name   oriT_pKP2722-2 in_silico
Organism   Klebsiella pneumoniae strain KP2722
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP116905 (39472..39595 [-], 124 nt)
oriT length   124 nt
IRs (inverted repeats)      101..106, 119..124  (TTTAAT..ATTAAA)
 91..99, 113..121  (AATAATGTA..TACATTATT)
 90..95, 107..112  (AAATAA..TTATTT)
 39..46, 49..56  (GCAAAAAC..GTTTTTGC)
 3..10, 15..22  (TTGGTGGT..ACCACCAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 124 nt

>oriT_pKP2722-2
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATTAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4066 GenBank   NZ_CP116905
Plasmid name   pKP2722-2 Incompatibility group   IncFII
Plasmid size   134875 bp Coordinate of oriT [Strand]   39472..39595 [-]
Host baterium   Klebsiella pneumoniae strain KP2722

Cargo genes


Drug resistance gene   blaKPC-2, blaSHV-12, rmtB, blaTEM-1B, blaCTX-M-65
Virulence gene   -
Metal resistance gene   silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, merR, merT, merP, merA, merD, merE, silE, silS, silR, silC, silF, silB
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIE9