Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   103622
Name   oriT_pKP2722-1 in_silico
Organism   Klebsiella pneumoniae strain KP2722
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP116904 (141045..141072 [-], 28 nt)
oriT length   28 nt
IRs (inverted repeats)      16..21, 23..28  (ATCAGA..TCTGAT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 28 nt

>oriT_pKP2722-1
AGTTTGGTGCTTATGATCAGAATCTGAT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4065 GenBank   NZ_CP116904
Plasmid name   pKP2722-1 Incompatibility group   IncFIB
Plasmid size   181653 bp Coordinate of oriT [Strand]   141045..141072 [-]
Host baterium   Klebsiella pneumoniae strain KP2722

Cargo genes


Drug resistance gene   -
Virulence gene   iutA, iucC, iucB, iucA
Metal resistance gene   pbrA, terW, terZ, terA, terB, terC, terD, terE
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -