Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 103602
• Name: oriT_36|P4
• Organism: Klebsiella oxytoca isolate 36
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_OW968316 (90..148 [+], 59 nt)
• oriT length: 59 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 59 nt

>oriT_36|P4
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 4045
• GenBank: NZ_OW968316
• Plasmid name: 36|P4
• Incompatibility group: ColRNAI
• Plasmid size: 2496 bp
• Coordinate of oriT [Strand]: 90..148 [+]
• Host baterium: Klebsiella oxytoca isolate 36

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -