Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 103601
• Name: oriT_36|P3
• Organism: Klebsiella oxytoca isolate 36
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_OW968315 (914..971 [-], 58 nt)
• oriT length: 58 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 58 nt

>oriT_36|P3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 4044
• GenBank: NZ_OW968315
• Plasmid name: 36|P3
• Incompatibility group: ColRNAI
• Plasmid size: 3223 bp
• Coordinate of oriT [Strand]: 914..971 [-]
• Host baterium: Klebsiella oxytoca isolate 36

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -