Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   103578
Name   oriT_147|P4 in_silico
Organism   Klebsiella pneumoniae isolate 147
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OW970525 (6200..6251 [-], 52 nt)
oriT length   52 nt
IRs (inverted repeats)      6..14, 17..25  (CGCAAAATT..AATTTTGCG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 52 nt

>oriT_147|P4
AAATCCGCAAAATTTTAATTTTGCGTAGTGTGTGGATATTTTTAGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4021 GenBank   NZ_OW970525
Plasmid name   147|P4 Incompatibility group   Col440I
Plasmid size   7926 bp Coordinate of oriT [Strand]   6200..6251 [-]
Host baterium   Klebsiella pneumoniae isolate 147

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -