Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103578 |
| Name | oriT_147|P4  |
| Organism | Klebsiella pneumoniae isolate 147 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_OW970525 (6200..6251 [-], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | 6..14, 17..25 (CGCAAAATT..AATTTTGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT_147|P4
AAATCCGCAAAATTTTAATTTTGCGTAGTGTGTGGATATTTTTAGTGGTGAG
AAATCCGCAAAATTTTAATTTTGCGTAGTGTGTGGATATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4021 | GenBank | NZ_OW970525 |
| Plasmid name | 147|P4 | Incompatibility group | Col440I |
| Plasmid size | 7926 bp | Coordinate of oriT [Strand] | 6200..6251 [-] |
| Host baterium | Klebsiella pneumoniae isolate 147 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |