Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 103518 |
Name | oriT_105_1_LWG_A|plas1 |
Organism | Escherichia albertii strain 105_1_LWG_A |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP099913 (30951..31302 [-], 352 nt) |
oriT length | 352 nt |
IRs (inverted repeats) | 255..262, 271..278 (ACCGCTAG..CTAGCGGT) 192..198, 206..212 (TATAAAA..TTTTATA) 40..47, 50..57 (GCAAAAAC..GTTTTTGC) 4..11, 16..23 (TTGGTGGT..ACCACCAA) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 352 nt
>oriT_105_1_LWG_A|plas1
AGGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTTTCTTTATAAATAGAGTGTTATGAAAAATTAGTTTCTCTTACTCTCTTTATGATATTTAAAAAAGCGGTGTCGGCGCGGCTACAACAACGCGCCGACACCGCTTTGTAGGGGTGGTACTGACTATTTTTATAAAAAACATTATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTATAGGATACCGCTAGGGGCGCTGCTAGCGGTGCGTCCCTGTTTGCATTATGAATTTTAGTGTTTCGAAATTAACTTTATTTTATGTTCAAAAAAGGTAATCTCTA
AGGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTTTCTTTATAAATAGAGTGTTATGAAAAATTAGTTTCTCTTACTCTCTTTATGATATTTAAAAAAGCGGTGTCGGCGCGGCTACAACAACGCGCCGACACCGCTTTGTAGGGGTGGTACTGACTATTTTTATAAAAAACATTATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTATAGGATACCGCTAGGGGCGCTGCTAGCGGTGCGTCCCTGTTTGCATTATGAATTTTAGTGTTTCGAAATTAACTTTATTTTATGTTCAAAAAAGGTAATCTCTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 3961 | GenBank | NZ_CP099913 |
Plasmid name | 105_1_LWG_A|plas1 | Incompatibility group | IncFIB |
Plasmid size | 60370 bp | Coordinate of oriT [Strand] | 30951..31302 [-] |
Host baterium | Escherichia albertii strain 105_1_LWG_A |
Cargo genes
Drug resistance gene | - |
Virulence gene | espL2 |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |