Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   103518
Name   oriT_105_1_LWG_A|plas1 in_silico
Organism   Escherichia albertii strain 105_1_LWG_A
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP099913 (30951..31302 [-], 352 nt)
oriT length   352 nt
IRs (inverted repeats)      255..262, 271..278  (ACCGCTAG..CTAGCGGT)
 192..198, 206..212  (TATAAAA..TTTTATA)
 40..47, 50..57  (GCAAAAAC..GTTTTTGC)
 4..11, 16..23  (TTGGTGGT..ACCACCAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 352 nt

>oriT_105_1_LWG_A|plas1
AGGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTTTCTTTATAAATAGAGTGTTATGAAAAATTAGTTTCTCTTACTCTCTTTATGATATTTAAAAAAGCGGTGTCGGCGCGGCTACAACAACGCGCCGACACCGCTTTGTAGGGGTGGTACTGACTATTTTTATAAAAAACATTATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTATAGGATACCGCTAGGGGCGCTGCTAGCGGTGCGTCCCTGTTTGCATTATGAATTTTAGTGTTTCGAAATTAACTTTATTTTATGTTCAAAAAAGGTAATCTCTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3961 GenBank   NZ_CP099913
Plasmid name   105_1_LWG_A|plas1 Incompatibility group   IncFIB
Plasmid size   60370 bp Coordinate of oriT [Strand]   30951..31302 [-]
Host baterium   Escherichia albertii strain 105_1_LWG_A

Cargo genes


Drug resistance gene   -
Virulence gene   espL2
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -