Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103515 |
| Name | oriT_pCRKP-27_Vir  |
| Organism | Klebsiella pneumoniae strain CRKP-27 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP102631 (141009..141036 [-], 28 nt) |
| oriT length | 28 nt |
| IRs (inverted repeats) | 16..21, 23..28 (ATCAGA..TCTGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 28 nt
>oriT_pCRKP-27_Vir
AGTTTGGTGCTTATGATCAGAATCTGAT
AGTTTGGTGCTTATGATCAGAATCTGAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3958 | GenBank | NZ_CP102631 |
| Plasmid name | pCRKP-27_Vir | Incompatibility group | IncFIB |
| Plasmid size | 177347 bp | Coordinate of oriT [Strand] | 141009..141036 [-] |
| Host baterium | Klebsiella pneumoniae strain CRKP-27 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | rmpA, iutA, iucC, iucB, iucA |
| Metal resistance gene | silR, silC, silF, silB, silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pbrA, silE, terW, terZ, terA, terB, terC, terD, terE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |