Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103514 |
| Name | oriT_pCRKP-35_KPC  |
| Organism | Klebsiella pneumoniae strain CRKP-35 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP102639 (128232..128355 [+], 124 nt) |
| oriT length | 124 nt |
| IRs (inverted repeats) | 101..106, 119..124 (TTTAAT..ATTAAA) 91..99, 113..121 (AATAATGTA..TACATTATT) 90..95, 107..112 (AAATAA..TTATTT) 39..46, 49..56 (GCAAAAAC..GTTTTTGC) 3..10, 15..22 (TTGGTGGT..ACCACCAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_pCRKP-35_KPC
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATTAAA
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATTAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3957 | GenBank | NZ_CP102639 |
| Plasmid name | pCRKP-35_KPC | Incompatibility group | IncR |
| Plasmid size | 132749 bp | Coordinate of oriT [Strand] | 128232..128355 [+] |
| Host baterium | Klebsiella pneumoniae strain CRKP-35 |
Cargo genes
| Drug resistance gene | blaSHV-12, blaKPC-2, blaCTX-M-65, blaTEM-1B, rmtB |
| Virulence gene | - |
| Metal resistance gene | merE, merD, merA, merP, merT, merR, pcoS, pcoR, pcoD, pcoC, pcoB, pcoA, silP, silA, silB, silF, silC, silR, silS, silE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |