Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103512 |
| Name | oriT_pCRKP-36_KPC  |
| Organism | Klebsiella pneumoniae strain CRKP-36 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP102642 (33293..33342 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pCRKP-36_KPC
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3955 | GenBank | NZ_CP102642 |
| Plasmid name | pCRKP-36_KPC | Incompatibility group | IncR |
| Plasmid size | 70511 bp | Coordinate of oriT [Strand] | 33293..33342 [-] |
| Host baterium | Klebsiella pneumoniae strain CRKP-36 |
Cargo genes
| Drug resistance gene | blaKPC-2 |
| Virulence gene | - |
| Metal resistance gene | merE, merD, merA, merP, merT, merR |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |