Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 103442 |
Name | oriT_pSL12517-mcr10.1 |
Organism | Enterobacter cloacae strain SL125_17 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_MW048777 (41122..41216 [+], 95 nt) |
oriT length | 95 nt |
IRs (inverted repeats) | 73..78, 85..90 (AAAAAA..TTTTTT) 73..78, 84..89 (AAAAAA..TTTTTT) 27..34, 37..44 (AGCGTGAT..ATCACGCT) 13..19, 31..37 (TAAATCA..TGATTTA) |
Location of nic site | 55..56 |
Conserved sequence flanking the nic site |
GGTGTATAGC |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 95 nt
>oriT_pSL12517-mcr10.1
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 3885 | GenBank | NZ_MW048777 |
Plasmid name | pSL12517-mcr10.1 | Incompatibility group | IncFIA |
Plasmid size | 58151 bp | Coordinate of oriT [Strand] | 41122..41216 [+] |
Host baterium | Enterobacter cloacae strain SL125_17 |
Cargo genes
Drug resistance gene | tet(D), catA2, aac(3)-IId, qnrS1, aph(6)-Id, aph(3'')-Ib, sul2, dfrA14, mcr-10 |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |