Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103399 |
| Name | oriT_pFIA-R |
| Organism | Klebsiella pneumoniae strain 9 isolate |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MT809692 (39879..39973 [-], 95 nt) |
| oriT length | 95 nt |
| IRs (inverted repeats) | 73..78, 85..90 (AAAAAA..TTTTTT) 73..78, 84..89 (AAAAAA..TTTTTT) 27..34, 37..44 (AGCGTGAT..ATCACGCT) 13..19, 31..37 (TAAATCA..TGATTTA) |
| Location of nic site | 55..56 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 95 nt
>oriT_pFIA-R
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3842 | GenBank | NZ_MT809692 |
| Plasmid name | pFIA-R | Incompatibility group | IncR |
| Plasmid size | 72483 bp | Coordinate of oriT [Strand] | 39879..39973 [-] |
| Host baterium | Klebsiella pneumoniae strain 9 isolate |
Cargo genes
| Drug resistance gene | blaKPC-39, mph(E), msr(E), armA |
| Virulence gene | - |
| Metal resistance gene | merR, merT, merP, merC, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |