Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   103387
Name   oriT_pST1030-3 in_silico
Organism   Salmonella enterica subsp. enterica serovar Typhimurium
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_MT507881 (6234..6517 [+], 284 nt)
oriT length   284 nt
IRs (inverted repeats)      245..250, 253..258  (CGCCCC..GGGGCG)
 119..125, 139..145  (GCGGTGT..ACACCGC)
 31..37, 42..48  (GCAAAAA..TTTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 284 nt

>oriT_pST1030-3
GTTCTCATGCCTGAAATGCCCACACCCCACGCAAAAACAATTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGACAAATTAGTTCTTCTTGCTCTCTTTGTGATATTTAAAAAAGCGGTGTCGGCGCAGCTACAACACCGCGCCGACACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAACATCATCTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTACAGGACGCCCCTGGGGGCGCTGCTAGGGGTGTCTGTTCAGATATG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3830 GenBank   NZ_MT507881
Plasmid name   pST1030-3 Incompatibility group   ColRNAI
Plasmid size   6760 bp Coordinate of oriT [Strand]   6234..6517 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Typhimurium

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -