Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 103298 |
| Name | oriT_p1107-118K  |
| Organism | Escherichia coli strain 1107 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MH580302 (81496..81619 [-], 124 nt) |
| oriT length | 124 nt |
| IRs (inverted repeats) | 101..106, 119..124 (TTTAAT..ATTAAA) 91..99, 113..121 (AATAATGTA..TACATTATT) 90..95, 107..112 (AAATAA..TTATTT) 39..46, 49..56 (GCAAAAAC..GTTTTTGC) 3..10, 15..22 (TTGGTGGT..ACCACCAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_p1107-118K
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATTAAA
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATTAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3741 | GenBank | NZ_MH580302 |
| Plasmid name | p1107-118K | Incompatibility group | IncFIB |
| Plasmid size | 118160 bp | Coordinate of oriT [Strand] | 81496..81619 [-] |
| Host baterium | Escherichia coli strain 1107 |
Cargo genes
| Drug resistance gene | aph(3')-Ia, sul3, aac(3)-IId, sitABCD |
| Virulence gene | iroB, iroC, iroD, iroE, iroN |
| Metal resistance gene | merR |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |